The genetic computer

687px-Wellcome_genome_bookcase

We live in a highly computerized society (the concept of the Internet of Things) where not only are there a lot of electronic devices abound, you probably have a computer on your person right now. Think of how many people in the world have a smartphone (surprisingly, I don’t – I’m just cheap). According to Experts Exchange, the guidance systems used in the Apollo missions have only twice the computing capability of the old Nintendo Entertainment System (or Famicom for you video game hipsters out there). That’s right – with half of the RAM that NASA used to guide Apollo 11 to the moon, I’ve been using it to save the Kingdom of Hyrule.

O0KRHUO
Source: Experts Exchange, http://pages.experts-exchange.com/processing-power-compared/

My old Sega Genesis (CPU Speed: 7.6 MHz, RAM: 72 KB) would have blown away the Apollo guidance systems. No contest.

All this computerization requires a lot of resources, especially silicon to make chips. There may be a lot of it around, but we may need more due to the sheer amount of data that is generated from all computers. Here’s a nifty infographic, and this is just from the Internet in one minute. What about from office Intranets and other private networks? What about data that isn’t connected, like USB drives? Also (and if you’re born in the Nintendo generation, please brace yourself) some of our old video games are developing amnesia.  Hyrule will forget the name of their greatest hero (I pretty much have, but it’s probably inappropriate anyway). And that doesn’t even include the metrics for Pokémon Go. That data can become staggering in a very short amount of time. So, what can we do? Scientists propose using genetic material.

They’re serious – memory devices running on DNA rather than silicon wafers. Why? Think about it: our biology teachers (especially the better ones, and you likely remember who they are) often tell us that DNA is data that the cell reads and carries out its instructions. Without oversimplifying it, that’s pretty much what it is. We can apply that thinking to computer data as well; our human genome is pretty much the data of what we are, and it can be recorded and documented. See the featured image? I had to crop it, but the entire human genome is recorded in those books, and depending on who you ask, it can easily fit into a flash drive. So it really is possible to work with DNA as a form of data storage. But how?

Data in our computers is a long series of binary code. Every time you see a long string of ones and zeroes in science function, that’s binary. What our computers do – and they’ve been getting faster and faster at it, remember the first infographic above – is write, transmit, and read data in binary. There’s a lot of explanations on why computers use binary that we won’t explore here (but you could if you’re so inclined), but let me demonstrate what happens, using one of my favorite quotes from a book:

01001001 00100000 01100001 01101100 01110111 01100001 01111001 01110011 00100000 01110100 01101000 01101111 01110101 01100111 01101000 01110100 00100000 01110100 01101000 01100101 01110010 01100101 00100000 01110111 01100001 01110011 00100000 01110011 01101111 01101101 01100101 01110100 01101000 01101001 01101110 01100111 00100000 01100110 01110101 01101110 01100100 01100001 01101101 01100101 01101110 01110100 01100001 01101100 01101100 01111001 00100000 01110111 01110010 01101111 01101110 01100111 00100000 01110111 01101001 01110100 01101000 00100000 01110100 01101000 01100101 00100000 01110101 01101110 01101001 01110110 01100101 01110010 01110011 01100101

Ha-ha! Oh, my sides. Wait – you didn’t get it? Of course you don’t – you weren’t trained to read in binary (me neither). This is how computers read my favorite quote, which is from The Restaurant at the End of the Universe by Douglas Adams (1980). For those of us who prefer to read our novels instead of mathing them out, here’s how the above binary string translates, according to Roubaix Interactive:

“I always thought there was something fundamentally wrong with the universe.” (note: the binary code did not include punctuation marks)

A computer that runs on genetics doesn’t run on binary, it would run on base 4, or quaternary. Binary is base 2 because its values are based on 0 and 1. Western (and a lot of Eastern, as far as I know) counting systems are base 10 (or decimal) because all values are based on 0 through 9. So base 4 would be – you guessed it. 0, 1, 2, and 3. Why bring this up? Because our genes are long sequences of only four molecules: adenine (A), guanine (G), cytosine (C), and thymine (T):

411px-dna_chemical_structure-svg
(source: Wikimedia Commons/Public Domain, author: Madeleine Price Ball)

That’s right, just like all English words are just sequences of 26 letters and all music are just sequences of 12 tones, all genetics is based on the order of four molecules (chew on that). So what would my favorite quote look like? Well, if we’re going to run it through a “genetic” computer, it would probably have to translate it into quaternary. I had to do this the long way using some basic tools around the Internet (there’s no direct translation between English and quaternary/base 4 yet), but here’s what I get:

10210200120112301313120113211303020013101220123313111213122013100200131012201211130212110200131312011303020013031233123112111310122012211232121302001212131112321210120112311211123213101201123012301321020013131302123312321213020013131221131012200200131012201211020013111232122113121211130213031211

With a little genetic magic (OK, I used Microsoft Word, you got me, leave me alone), we can translate it into genetic code by using adenine for 0, guanine for 1, cytosine as 2, and thymine as 3:

GATGATAAGTAGGTCAGCGCGTAGGCTGGCACATAAGCGAGTTAGTCCGCGGGTGCGTTAGCGAATAAGCGAGTTAGTGGGCATGTGGATAAGCGCGTAGGCACATAAGCACGTCCGTCGGTGGGCGAGTTAGTTGGTCTGTGCATAAGTGTGCGGGTCTGTGAGTAGGTCGGTGGGTCTGCGAGTAGGTCAGTCAGCTGATAAGCGCGCATGTCCGTCTGTGCATAAGCGCGTTGGCGAGTTAATAAGCGAGTTAGTGGATAAGCGGGTCTGTTGGCGTGTGGGCATGCACGTGG

There we go – one sentence, expressed as a strand of DNA. Keen, huh?

Could genetic data storage be a viable alternative to silicon-based devices? There’s a lot going for it – it requires very low power and it can keep itself together for a very long time. You can store literally any kind of data that you well please. Can it be retrieved and read back into some form we can understand, like a human language? What about rewriting data? It’s easy enough to write it the first time, but what if one has to rewrite something? It’s not just a matter of ‘flipping switches’ on or off (which is what most of binary is really), but rewriting genetic data means that you are essentially telling your data to mutate. Then it gets complicated. Computer engineering may have to take on a completely different structure, including the math, logic,  and programming languages that goes into putting together the programs and apps that support and irritate our ever-so-digitized lives.

Before anyone gets into a snit, relax, they’re not going to upload long genetic ‘text’ into your body. After all, who knows what it can actually do to the human body? I don’t want to know what happens if someone uploads anything from the Cthulhu mythos or the works of H. R. Giger into their genome. Should you try it though, please let us know here at sci.casual. We may need to get in touch.

Featured image source: Wikimedia Commons (English Wikipedia, CC-BY-30, user: Russ London)

57 Comments

  1. I’m eager to see where computer science takes us. When those “hoverboards” the Segway with no handles came out my brother said, “look it’s Wall-E in the making.” But if we can code from binary to DNA the possibilities are endless for humans, if we use it to our advantage

    Liked by 10 people

      1. One has only to look at major scientific and technological innovations from the jet airplane to dynamite to atomic energy to space science to the totally intrusive internet to understand the dark side of human utilization of technological innovation. No doubt many good things have come about but the negatives may be the end of everything.

        Liked by 2 people

      1. I am well pleased to stumble upon your post. But a book I read about h a language was created long ago and your post has shown me the way/breakthrough to code from binary to quaternary…. I am so happy & fulfilled dear!

        Liked by 2 people

  2. There are two outstanding qualities about DNA memory. The first is that it is stable for a very long time and the second is that it takes very little space. One tiny cell contains the architecture for a very complex human being, or an oyster or a mushroom or a whale. All of human knowledge can be preserved in a very small space and if reproduced in quantity can be dispatched like cosmic dust into the universe to be decoded where ever it might find use. A speck of this implanted properly with the decoding mechanism into any human brain could be most useful. Or, like most human revolutionary technologies, could destroy or cripple civilizations.

    Liked by 7 people

      1. One general concept that occurs to me is the possibility of direct transference of external DNA information into an organism to mutate it creatively to make it more disease resistant or even innovate new internal organs or even external architecture such as a microscopic or telescopic eye or make one organically aware of radioactivity or incoming information from radio satellites. It could possibly supplant a cell phone or give one the sonic capabilities of a bat or dolphin. Even today yeasts are modified to produce pharmaceuticals through melding DNA from other living things but this is a rather clumsy way to accomplish internal changes. Information could be directly transmitted by photo or electromagnetic transfer which would, of course create all sorts of dangerous instabilities from stray random influences so multiple problems would have to be faced.

        Liked by 5 people

    1. The most complicated part of this is what kind of software and hardware architecture is going to have to be developed in order for this to be a thing. Then there’s the whole thing (oh, there’s going to be) about the ethics of genetic editing in vivo if we get that far. For now, I think the biotech landscape is still playing with the idea of using DNA as a robust, low-energy medium for long-term data storage.

      As for quantum computing, last I checked it’s more of an efficiency issue. I just haven’t been looking very hard at it because I couldn’t come up with any wisecracks.

      Liked by 2 people

      1. You sparked my interest about genetic computing because, as you say, binary wouldn’t work and that’s where I thought quantum, which I understand, by its very nature, is far more than binary, and more like reggae drumming hitting offbeats

        Liked by 2 people

    1. Oh, it’s not so bad. Right now it’s just figuring out that we could use DNA to store information. It’s going to get weird if we start injecting it into living tissue, but that’s why scientists deal with ethics issues as well.

      Liked by 2 people

  3. What about speed? If a chemical reaction is needed to read and write data isn’t that a lot slower than electronic processes? If so then genetic storage could become the “hard disks” of the future, used for archiving bulk data, while SSD-type devices are used for primary storage.

    Liked by 5 people

    1. Almost all informational bulk storage systems today deteriorate over time and lack of proper equipment to use it for informational source. DNA seems to be exceptionally durable and highly compact and might be ideal for a concept I had some time ago.

      As a person lives he or she spends an active life evolving and involved in many various activities. The miserably meager information on a tombstone gives even less understanding of a total life than an old telephone book and a proper permanent storage system could be quite valuable in recording a huge amount of detail of an individual for family records and even a complex bank of information for academic records for an entire civilization.

      An institution like an insurance company could be established to record a person’s life with annual visits by a camera crew and editorial staff to solidify a person’s life as it is lived and when the inevitable occurs the entire life with videos and sound and all sorts of historically worthy current events compounded into a totality that could be stored in an elaboration of the standard cemetery so that family and researchers could not only view a person’s life but perhaps even converse with a dynamic reproduction of the person’s character to get a feel for an era and the quality of an individual and his or her associates. It could become a valuable business operation requiring skilled professionals and if it became general with accepted routines it would be affordable for the average person. In effect it would the democratic equivalent of the old Egyptian tombs of kings but could encapsulate in wonderful detail an entire human culture for future reference.

      Liked by 4 people

  4. Somehow, with the help of a strong and heavy stave, I got to the end of that. It is a LOOONG time since I have read heavy things like Science! Haha!

    But, my Dear Dermott, I ‘AM’ in a snit. Just HOW do You know ‘they’re not going to upload long genetic ‘text’ into your body?’ Eh? Any guarantees? I want a written one, please.

    Yeah, ‘Who knows what it can actually do to the human body?’ First of all, let me clarify, I don’t. Honest. But Worse is yet to come. With the kind of Mad politicos, Scientists and military generals that We have, Do We Really think any of them Care What that could do the Ordinary Citizen’s body-phody? Ha.

    Any way, let me make and take a cup of tea, and a small little walk.🙂

    Good write-up, my Dear Dermott! Regards.

    Liked by 2 people

  5. Things that make you go hmmmmmmm. Okay, I get it, but my burning question is how? How will the DNA work without an organism? Will a germ be created that allows the substance to live on the outside of the body? It’s the body that tells DNA what to do, so again, hmmmmmmm. I do not doubt scientific technology has developed a way for this happen. Look at stem cells and how miraculous they are. Besides creating a real, honest to goodness Cylon, to carry this DNA, I can’t seem to make it work in my head and I want to. I don’t really think it’s the best idea, however, being a big fan of science, I’m wholly curious. The only way I can think this would work is that some how the connection from computer to DNA is through electrons. We have them and electrons are part of what stuff is made of…so, hmmmmmm.

    Great post.

    Liked by 2 people

    1. When it comes down to it, DNA is really just chemicals and not anything particularly living. *Making* a DNA sequence, with our current understanding of biosciences, is possible outside of cells: http://grow.cals.wisc.edu/health/how-to-make-dna-2

      For now, they just want to see what else they can do with it apart from making it a highly-stable low-energy form of data storage. Right now, all they could do is save an MP3 as genetic data. Not bad, considering I need a backup for my music collection…

      Liked by 1 person

      1. Although the USA is and has been the center of main technological developments in the world other nations such as China and India and many European centers are moving up in basic scientific and technological innovation. There are already complaints in the digital industries in the USA that there is a lack of competent people locally and a need to use immigrants to fill the gap. Something has to give here or the USA will have real difficulties. The Chinese have just launched a quantum satellite to guarantee security in communications which places it in the forefront of that area. It is a signal that cutting edge research cannot be neglected.

        Liked by 2 people

  6. This was a great article! One question though. Why are there so many assumptions that we would use human DNA for this? That would be crazy stupid. Obviously, this would start with microbial DNA. One additional point to make is that although slower, this type of computing can do something like 60 procedures at once, unlike any computer processor to date. Therefore, you would never use this for basic computing. You might use this for supercomputing though.

    Liked by 2 people

    1. There’s really no such thing as ‘human’ DNA and ‘microbial’ DNA. DNA is simply chemical compounds. However, there are human and microbial *genomes*, which are specific sequences of DNA that separate organisms at the genetic level.

      For example, when Microsoft encoded the music video to OK GO’s “This Too Shall Pass”, that DNA wasn’t particularly ‘human’ or ‘microbial’ – it was just a sequence of chemicals (DNA) that could (this is just my guess – not a lot of details in the news as to how they did it when I started looking) be translated via into binary, which could then be translated again into audio and video signals.

      Liked by 1 person

      1. Good point! DNA is just amino acids. I was referring to where that DNA would be stored. Doesn’t the DNA need something like a a virus or spores to keep it stable? To place this DNA in directly into humans would be grossly irresponsible. For another clarification, RNA would do the actual “writing” / creation of the data into DNA, right?

        Like

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s